Leita Ý frÚttum mbl.is
Embla

A­ skrß erf­amengi mannsins

Hva­ felst Ý ■vÝ a­ skrß erf­amengi mannsins og hva­ hefur ■a­ Ý f÷r me­ sÚr?

Ůessari spurningu um skrßningu erf­amengis mannsins var svara­ af Gu­mundi Eggertssyni ß fyrsta starfsßri VÝsindavefsins, ßri­ 2000. SÝ­an ■ß hefur řmislegt gerst ß svi­i erf­avÝsindanna og ■vÝ full ßstŠ­a til a­ svara spurningunni ß nřjan leik. Eldra svari­ stendur ■ˇ enn fyrir sÝnu, sjß: Hva­ felst Ý ■vÝ a­ skrß erf­amengi mannsins og hva­ hefur ■a­ Ý f÷r me­ sÚr?

HÚr birtist svar sem vi­ ritu­um Ý sumar fyrir vÝsindavefinn.

Erf­aefni­ Ý ÷llum lÝfverum ß j÷r­inni er DNA-kjarnsřra. DNA er gormlaga og ber Ý sÚr upplřsingar um byggingu og starfsemi lÝfvera, hin svok÷llu­u gen. Kjarnsřran er tveir ■rŠ­ir sem tvinnast saman og parast me­ ßkve­num einingum sem kallast kirni e­a basar. Kirnin parast samkvŠmt efnafrŠ­ilegum eiginleikum ■annig a­ A parast vi­ T, og C parast vi­ G. ┴ri­ 1970 var kunngj÷r­ a­fer­ sem ger­i kleift a­ greina r÷­ basa Ý b˙tum erf­aefnis. Margar lÝfefnafrŠ­ilegar a­fer­ir voru prˇfa­ar Ý upphafi og enn eru nřjar a­fer­ir Ý ■rˇun. Saman eru ■essar a­fer­ir kalla­ar DNA-ra­greiningar, og ■Šr nřtast til a­ lesa r÷­ basanna sem mynda genin og a­ra hluti erf­amengisins. Fyrsta ra­greiningin ß heilu erf­amengi var ß veirunni MS2 ßri­ 1976 og fyrsta bakterÝan, Haemophilus influenzae, var ra­greind 1995.

R÷­ basa Ý DNA mß greina me­ efnahvarfi ■ar sem hver basi er lita­ur me­ sÚrst÷kum fl˙orljˇmandi hˇpi. Mismunur ß sta­setningu og styrk ljˇss ß fjˇrum bylgjulengdum segir til um r÷­ basa Ý ßkve­num DNA-b˙t e­a geni.

Samfara tŠkniframf÷rum kom upp s˙ hugmynd a­ skrß e­a ra­greina erf­amengi mannsins. Ůa­ var mikil ßskorun ■vÝ erf­amengi Homo sapiens er m÷rgum sinnum stŠrra en erf­amengi veira og bakerÝa. MS2-veiran hefur um 3.000 kirnap÷r en eitt sett af litningum okkar (23 alls) samanstendur af um ■a­ bil 3.200.000.000 kirnap÷rum. Ef litningar mannsins vŠru skrifa­ir ˙t Ý s÷mu leturstŠr­ og n÷fn Ý sÝmaskrß, ■yrfti um 200 sÝmaskrßr til a­ rita ˙t eitt erf­amengi (mi­a­ vi­ 1000 bls. skrßr). Ra­greining erf­amengis mannsins var risavaxi­ verkefni, sem ■arfna­ist mikils skipulags og fjßrmagns. BandarÝsk yfirv÷ld, me­ li­sinni Kanadamanna og Breta h÷nnu­u ■repaskipt verkefni sem ßtti a­ taka r˙m 10 ßr. Einkaa­ilar, undir forystu Craig Venter, v÷ldu a­ra nßlgun og fˇru Ý kapp vi­ hi­ opinbera. Markmi­ Venter var a­ sŠkja um einkaleyfi ß genum. S˙ hugmynd var felld ■vÝ nßtt˙rulegar erf­aupplřsingar lÝfvera eru ekki uppfinning. Engu a­ sÝ­ur var­ miki­ kapphlaup um a­ lj˙ka ra­greiningu erf­amengisins. Kapphlaupinu lauk me­ jafntefli og sumari­ 2000 var fyrsta ˙tgßfa af erf­amengi mannsins kynnt ß bla­amannafundi ß t˙ni ■ßverandi BandarÝkjaforseta, Bills Clintons. VÝsindagreinar um erf­amengi­ birtust sÝ­an Ý febr˙ar 2001. Me­ ■vÝ a­ skrß erf­amengi mannsins var r÷­ basanna Ý genum og ß litningum ßkv÷r­u­. Einnig var hŠgt a­ skilja r÷­ gena, byggingu og sta­setningu ■eirra ß litningum. Til dŠmis byrjar geni­ Evx ß atggagagccgaaaggacatggttatgtttctgga, og ■a­ liggur vi­ hli­ina ß RNA-geninu HOTTIP. Ra­greiningin afhj˙pa­i lÝka a­ra hluti erf­amengja og litninga, eins og ■rß­h÷ft, st÷kkla, stjˇrnsvŠ­i og endurtekningar. En tŠknin og ra­greiningar eru ˇfullkomnar. Sum svŠ­i Ý erf­amengi dřra og plantna hafa ■a­ margar endurtekningar og st÷kkla a­ ekki hefur tekist a­ ra­greina ■au. Erf­amengi okkar er ■ekkt a­ stŠrstu leyti en nokkur hundru­ slÝk g÷t eru enn ˇfyllt. En ma­urinn ß ekki bara eitt erf­amengi. Vi­ eigum hvert tv÷ eint÷k af okkar eigin erf­amengi (eitt frß pabba og eitt frß m÷mmu) og ■au eru ekki eins. ŮvÝ ß mannkyni­ r˙mlega 14 milljar­a erf­amengja (tv÷ Ý hverjum einstaklingi). ┴stŠ­an er s˙ a­ Ý erf­aefninu eru frßvik, breytingar ß st÷kum kirnum e­a jafnvel heilum genum e­a litningahlutum. Ůessi frßvik kallast st÷kkbreytingar og ■au mß til dŠmis finna me­ ■vÝ a­ bera saman erf­amengi. ═ ljˇs kemur a­ a­ minnsta kosti 15.000.000 sta­ir Ý erf­amengi mannsins eru breytilegir. Ůar af lei­ir a­ allir eru erf­afrŠ­ilega einstakir. Breytileiki ß milli einstaklinga var ein af kveikjunum a­ ra­greiningu erf­amengis mannsins. Hugmyndin var a­ au­veldara vŠri a­ kortleggja gen sem tengjast sj˙kdˇmum, ef vi­ vissum byggingu erf­amengisins. Kortlagning gena byggist ß a­ kanna hva­a st÷kkbreytingar sřna fylgni vi­ sj˙kdˇm e­a einkenni, til dŠmis ■egar bornir eru saman 1000 astmasj˙klingar og 1000 heilbrig­ir (sjß mynd).

Til a­ greina ßhrif st÷kkbreytinga er tÝ­ni ■eirra borin saman hjß hˇpi sj˙klinga me­ ßkve­inn sj˙kdˇm og sambŠrilegum vi­mi­unarhˇp. ═ ■essu tilb˙na dŠmi eru ßhrif tveggja st÷kkbreytinga athugu­. Engin munur er ß tÝ­ni st÷kkbreytingar ß basa 1 Ý l÷snum og hraustum einstaklingum, en breyting ß basa 2 er greinilega algengari l÷snum en heilbrig­um.

Ůegar b˙i­ er a­ sta­festa a­ st÷kkbreyting tengist sj˙kdˇmi ■ß opnast m÷guleiki ß dřpri skilningi ß sj˙kdˇmnum og um lei­ me­fer­ e­a lŠkningu. En Ý m÷rgum tilfellum er bj÷rninn ekki unninn ■egar st÷kkbreyting finnst. Gu­mundur Eggertsson sag­i ßri­ 2000:
Ůess er ekki a­ vŠnta a­ ra­greining genamengisins valdi byltingu Ý mannerf­afrŠ­irannsˇknum. Frekar mß lÝta ß hana sem fyrsta ßfangann til fulls skilnings ß erf­aefni mannsins og starfsemi ■ess. NŠsti ßfangi ver­ur skilgreining ß ger­ og hlutverki allra ■eirra prˇtÝna sem ßkv÷r­u­ eru af erf­aefninu.
Or­ Gu­mundar eiga enn vi­. Jafnvel ■ˇtt a­ vi­ finnum erf­a■ßtt sem tengist sj˙kdˇmi, ■ß er mikil vinna fyrir h÷ndum a­ skilja hvernig hann hefur ßhrif ß sj˙kdˇminn. Ůetta vandamßl er ■vÝ flˇknara ■ar sem flestar st÷kkbreytingar eru meinlausar. ŮŠr hafa engin ßhrif ß svipfari­, ˙tlit e­a eiginleika fˇlks. ┴ ■eim r˙mleg 13 ßrum sem li­in eru frß ra­greiningu erf­amengis mannsins hafa tug■˙sundir erf­amengja veri­ ra­greind. Flest mengin eru ˙r bakterÝum, en einnig hafa erf­amengi tilraunalÝfvera eins og ßvaxtaflugna, gersveppa og vorskri­nablˇms veri­ skrß­. Einnig hafa erf­amengi r˙mlega 10.000 manns veri­ ra­greind og afhj˙pu­. G÷gn um tilraunalÝfverur eru a­gengileg Ý opnum gagnagrunnum, en vegna persˇnuverndar eru nŠstum ÷ll erf­amengi manna Ý loka­ri gagnav÷rslu. Erf­amengja÷ldin fŠr­i okkur erf­amengi mannsins, innsřn Ý sj˙kdˇma og lÝffrŠ­i okkar en einnig grÝ­arlega ■ekkingu ß fj÷lbreytileika dřra, plantna og ÷rvera. Samantekt:
  • DNA ra­greining er a­fer­ til a­ greina r÷­ basa Ý DNA.
  • Ra­greining erf­amengja afhj˙par r÷­ gena, byggingu ■eirra og ■rˇunarlegan skyldleika.
  • Ra­greining erf­amengis mannsins au­veldar leitina a­ erf­a■ßttum sem tengjast sj˙kdˇmum.
═tarefni:Myndir:

Bryngeddan og ■rˇun fiska

Mßnudaginn 18. ßg˙st mun Dr. John Postlethwait halda hßdegiserindi ß vegum LÝf- og umhverfisvÝsindastofnunar.

═ fyrirlestrinum mun Dr. Postlethwait prˇfessor vi­ Institute of Neuroscience, University of Oregon, Eugene, fjalla um rannsˇknir sÝnar og samstarfsmanna sinna ß erf­amengi s.k. bryngeddu (Lepisosteus aculatus), sem er ein 7 frumstŠ­ra tegunda beinfiska frß ÷­ru blˇmaskei­i beinfiska ß mi­lÝfs÷ld sem enn eru uppi. Greint ver­ur frß ■vÝ hvernig rannsˇknir ß erf­amengi ■essara älifandi steingervingaô geta nřst vi­ a­ varpa ljˇsi ß á■rˇun genamengja, gena og genastarfsemi n˙tÝma beinfiska og spendřra.

Titill erindisins er: Linking Teleost Fish Genomes to Human Biology
Ingo Braasch, Peter Batzel, Ryan Loker, Angel Amores, Yi-lin Yan, and John H. Postlethwait


Fyrirlesturinn ver­ur haldinn kl. 13:30-14:30 mßnudaginn 18. ┴g˙st Ý stofu N-131 Ý Ískju og er opinn ÷llum.
á
┴grip erindisins ß ensku.
Spotted gar (Lepisosteus oculatus), a holostean rayfin fish and one of Darwinĺs defining examples of Ĺliving fossilsĺ, informs the ancestry of vertebrate gene functions and connects vertebrate genomes. The gar and teleost lineages diverged shortly before the teleost genome duplication (TGD), an event with major impacts on the evolution of teleost genomes and gene functions. Evolution after the earlier two vertebrate genome duplication events (VGD1 & VGD2) also complicates the analysis of vertebrate gene family history and the evolution of gene function because lineage-specific genome reshuffling and loss of gene duplicates (ohnologs) can obscure the distinction of orthologs and paralogs across lineages and leads to false conclusions about the origin of vertebrate genes and their functions. We developed a Ĺchromonomeĺ (a chromosome-level genome assembly) for spotted gar. Analysis shows that gar retained many paralogs from VGD1 & VGD2 that were differentially lost in teleosts and lobefins (coelacanth, tetrapods). We further show that spotted gar can be reared as a laboratory model enabling the functional testing of hypotheses about the origin of rayfin and lobefin gene activities without the confounding effects of the TGD. The spotted gar genome sequence also helps identify cis-regulatory elements conserved between teleosts and tetrapods, thereby revealing hidden orthology among regulatory elements that cannot be established by direct teleost-tetrapod comparisons. Using whole genome alignments of teleosts, spotted gar, coelacanth, and tetrapods, we identify conserved non-coding elements (CNEs) that were gained and lost after various key nodes of vertebrate evolution. This information enables us to study on a genome-wide scale the role of regulatory sub- and neofunctionalization after the TGD and helps infer targets of cis-regulatory elements that we test in vivo using transgenic reporter assays. This living fossil links teleost genomes to human biology in health and disease.


Erf­amengun ˇgnar Ýslenskum l÷xum

G÷gn Vei­imßlastofnunar sřna a­ eldislax hafi fundist Ý Kleifaß ß Patreksfir­i. Ůetta eru vßleg tÝ­indi, ■vÝ eldislax er af norsku kyni og er hŠtta ß a­ hann blandist vi­ Ýslenskan lax. SlÝkir bl÷ndun getur leitt til ■ess a­ sta­bundnir stofnar deyji ˙t...

Formmyndun og tjßning miRNA tengd breytilegu ˙tliti h÷fu­s bleikjuafbrig­a

Ůri­judaginn 19. ßg˙st ver Kalina H. Kapralova doktorsritger­ sÝna Ý lÝffrŠ­i vi­ Hßskˇla ═slands. Heiti riger­arinnar er Formmyndun og tjßning miRNA tengd breytilegu ˙tliti h÷fu­s bleikjuafbrig­a (Salvelinus alpinus)/Study of morphogenesis and miRNA...

Nř tegund finka a­ myndast ß Galapagos?

Galapagoseyjar eru samofnar nafni Charles Darwin, og hugmyndinni um ■rˇun vegna nßtt˙rulegs vals . Eyjarnar myndu­ust vegna eldvirkni, og eru ansi ˇlÝkar Ý grˇ­urfari og a­stŠ­um. Ůegar finkutegund frß Su­ur AmerÝku nßmu land ß eyjunum fyrir milljˇnum...

ŮrÝr foreldar og erf­alŠkningar

Erf­alŠkningar eru ß teiknibor­inu, og hafa veri­ prˇfa­ar Ý nokkrum tilfellum. ŮŠr fela Ý sÚr a­ gera breytingar ß erf­aefni einstaklinga, til a­ lŠkna ■ß af sj˙kdˇmi e­a til a­ fyrirbyggja sj˙kdˇm. ŮŠr tilraunir sem ger­ar hafa veri­, hafa veri­ til a­...

NŠsta sÝ­a

Höfundur

Arnar Pálsson
Arnar Pálsson

Erfðafræðingur

┴g˙st 2014
S M Ů M F F L
          1 2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17 18 19 20 21 22 23
24 25 26 27 28 29 30
31            

Innskrßning

Ath. Vinsamlegast kveiki­ ß Javascript til a­ hefja innskrßningu.